edw3 edw3
  • 04-06-2018
  • Mathematics
contestada

The range of the function f(x) = x + 5 is {7, 9}. What is the function’s domain?
{2, 4}
{-2, -4}
{12, 14}
{-12, -14}
{0, 5}

Respuesta :

rajmihirshahp9s1he rajmihirshahp9s1he
  • 04-06-2018
If y is 7, x is 2. If y is 9, x is 4. Therefore the domain is {2,4}
Answer Link

Otras preguntas

How did Judaism differ from the religions of other ancient peoples? Hurry I need this ASAP!!
Read the excerpt below and answer the question. Willows whiten, aspens quiver, Little breezes dusk and shiver Through the wave that runs for ever By the island
(PHYSCOLOGY) Somatization disorders occur more often in men than in women. Please select the best answer from the choices provided T F
what does this mean 4x + 6y=9 12x + 18y=27
6 millones restado 300¿
What are the rules of binomial nomenclature
change from active to passive some one has taken my walet​
is it true that Composing was very easy for Beethoven and he worked very rapidly.
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
Identify Three Climate Issues