tulipjulip101
tulipjulip101 tulipjulip101
  • 03-08-2018
  • Mathematics
contestada

EMERGENCY! Please help. Either or both questions!!

EMERGENCY Please help Either or both questions class=

Respuesta :

lesliekolleroxrkcf
lesliekolleroxrkcf lesliekolleroxrkcf
  • 03-08-2018

Rectangle on top is 4 units by 8 units = 32 units squared.

The half circle has radius 2, so the area is pi*2^2/2 = 4pi /2 = 2pi

Total area is 32+2pi or approx 38.28 square units, answer C

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which expression is a difference? a.(6 - 4) x 5 b.6 - (4 x 5) c.8 + (5 - 2) d.(6 - 4)(3 - 1)?
What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?
What caused the gross domestic product of the united states to quadruple between 1860 and 1890?
Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7
Can someone please help me with numbers 1, a, b, c, 2, a, b, c
How do you find the length of the hypetnyuse if you have one angle and opposite side?
__________ is widely considered to be the founder of the professional american police department.
Which option would best fit in this diagram in the bubble labeled 1?
Which of the following can be a cause of social change?