Rondon1 Rondon1

02-08-2019
Biology

contestada

Which of the following is also called the law of conservation of energy

Respuesta :

RaeStudies RaeStudies

02-08-2019

Answer:

law of conservation of energy states that

energy cannot be created not destroyed, only converted from one form to another.

Answer Link

Otras preguntas

help me asap !!!!!!!!

PLEASE HELP ME !!!! Use I = PRT to solvEI = $350 P= $700 Find T (TIME IN YEARS) R= 10% (

The_____ form acidic compounds with hydrogen.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which component of a phospholipid is found in the interior of a lipid bilayer?

Why does an insertion mutation usually cause more defects during protein synthesis than a point mutation? a. insertion mutations only occur during transcription

Given the parent function of f(x) = x4, what change will occur when the function is changed to f, bracket one half x end bracket? A. Graph opens the same way an

Collusive strategies are the third type of cooperative strategies. In many economies, explicit collusive strategies are legal unless otherwise sanctioned by gov

Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall

why is derek miller's social media post different than most?