emilee80
emilee80 emilee80
  • 03-10-2019
  • Mathematics
contestada

i need help. i have no clue what the answer is

i need help i have no clue what the answer is class=

Respuesta :

albaniansoccer5
albaniansoccer5 albaniansoccer5
  • 03-10-2019

Answer:

1.7, and -0.9

Step-by-step explanation:

You can just add or subtract 1.3 to 0.4 and that gives you your answer.

Hope this helped!

<3

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re
find the greatest common divisor of 9 and 27
A man has blood type AB and his wife has blood type B. What are the possible blood types for their child
Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors
Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ
The tendency for people to become more extreme in their attitudes as a result of group discussion is called _______.
What country did Texas break away from to become independent?
What can you conclude about the impact U.S. involvement in Vietnam? A. It cost the lives of many people in the state and nation B. It encouraged unity and mili
The root word graph means to _____. speak, write, read