jagrutmahendra6 jagrutmahendra6
  • 01-03-2020
  • Mathematics
contestada

calculate the total volume of this hemisphere radius 9 give your answer in 1 decimal place ​

Respuesta :

amna04352
amna04352 amna04352
  • 01-03-2020

Answer:

1526.8 units³

Step-by-step explanation:

⅔ × pi × r³

⅔ × pi × 9³

= 486pi units³

= 1526.81403 units³

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which hormone is essential to our ability to maintain our fluid levels?
Which type of intelligence allows people to use their vision to develop mental images?
TRUE OR FALSE HELP QUICK
WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t
Billy has 1 gallon of paint. He is going to pour it into a paint tray that measures 10 inches wide, 14 inches long, and 4 cm deep. Which of the following scenar
what is the scale factor of a cube with a volume of 343 m^3 to a cube with a volume of 5'832 m^3?
Help! Exponential Equation WITHOUT CALCULATOR
Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2
(75) pointsPlease help me on these questions ASAP!!!