stephenmathurin472 stephenmathurin472
  • 04-04-2020
  • Mathematics
contestada

Two streets form an intersection. C and D are supplementary angles. If the measure of C is 128 and the measure of D is two times the value of x, what is the value of x?

Respuesta :

victorsingh1976 victorsingh1976
  • 04-04-2020

Answer:

x=26

Step-by-step explanation:

180-128 because supplementary angles are angles that add up to 180 degrees. D=52 and you would do 52 divided by 2. x=26

Answer Link

Otras preguntas

A farmer plans to build a 250 square feet rectangular chicken pen adjacent toher chicken coop. The coop wall will form one side of the fence but she needs tofen
3a x 5b x 7c = 39375, then find value of 7a - 2b + 3c​
Find the number that makes the ratio equivalent to 1:8.
2x-x+7=x+3+4 please help find the x
Answer THESES 3 FOR BRAINLIEST!!!!
Help me please……………………….……..
The measures of the angles of a triangle are shown in the figure above. Solve for X
what type of element are Fe, Co, Ni?​
Distributive Property. 12(6-1/2 x)?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'