volation080720 volation080720
  • 02-09-2020
  • Health
contestada

What is the most important thing you could do to improve your health? Why?

Respuesta :

Аноним Аноним
  • 02-09-2020

Answer:

Although it may be tempting to quantify health by a single, absolute standard, it's actually an accumulation of factors that contribute to overall health. “There are three key things that healthy people do every day: exercise, maintain a nutritious diet and get a good night's sleep.

Explanation:

Answer Link

Otras preguntas

Solve the equation -10 + 3x + 5x = -56 ? ??
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
what is 0.00001267 is scientific notation
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
why is the square root of a perfect square always rational
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l