piratefan7 piratefan7

02-10-2020
Social Studies

contestada

The political tension between the United States and the Soviet Union that followed World War II resulted in

Respuesta :

esther2014kim esther2014kim

07-10-2020

Answer:

The Cold War

Explanation:

Because it is now give me points. Kidding lol.

Answer Link

Otras preguntas

(60) Points HeLp asap 5 questions

20% of what number is equal to 2/3 of 90?

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall

What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid

Groups that are more formal and require less continuous interaction are known as what type of group?

Aerial photographs most often are taken from __________. A. aircrafts B. hot air balloons C. satellites D. space shuttles

Who can become an American citizen through the process of naturalization?

A person is selected at random from a crowd. You want to find the probability of the event that this person is a female and the probability of the event that th