efletcher011913 efletcher011913

04-01-2021
Mathematics

contestada

Which graph models the equation - 3x + 4y = 8?

Which graph models the equation 3x 4y 8 class=

Respuesta :

maryamasadovaoxf9o3 maryamasadovaoxf9o3

04-01-2021

it’s A.. hope this helps out :)

Answer Link

Otras preguntas

The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.

What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1

what is the difference in length between a 1 and 1/4 inch button and a 3/8 inch button

PLEASE I BEG YOU, HELP ME!!!!!!!! Find the rate of change of the function h(x) = 2^x on the interval 2 ≤ x ≤ 4. The rate of change is what?

PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single

Associating objects that elicit an undesirable response with unpleasant or negative stimuli describes the key principle of ____.

Which constitutional amendment allowed voting for citizens who were eighteen or older?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o