alinai0014 alinai0014

01-02-2021
Physics

contestada

What is the acceleration of a 19 kg bike pushed with a force of 340 N? F = ma
A) 6460 m/s
B) 18 m/s2
C) 17.6 m/s2

Respuesta :

jamesambern jamesambern

08-02-2021

Answer:

C

Explanation:

Answer Link

Otras preguntas

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

What value of x will make the equation below true? X - 15 = 12

True or false... When using the substitution method, one of the equations must say "x=" or "y=".

Any help ?!?!?!?!?!??

please help asap i didn’t pay attention in class

WILL GIVE BRAINLIEST!!! ____________________ Mr. Nicholson accepts a job that pays an annual salary of $60,000. In his employment contract, he is given the opti

Jason paid $50 to be a member of the Anglin Mighty Gym. When he takes 2 points the boxing class, it costs him $2. Erik is not a member of the Gym, and it costs

can somebody please help :)

What is the slope of the line X=-3?

Which option is an example of deductive reasoning?