rileyfaith109
rileyfaith109 rileyfaith109
  • 02-02-2021
  • Mathematics
contestada

22/44 in simplest form?

Respuesta :

lemonicecream520 lemonicecream520
  • 02-02-2021

Answer:

22/44, divide both sides by 22, then you would got 1/2

Answer Link
brianasmallwood
brianasmallwood brianasmallwood
  • 02-02-2021

1/2. This is because 22 is half of 44, so we can simplify it into 1/2.

Answer Link

Otras preguntas

"Peace Terms with Jerusalem, 636 CE," 10th century 1. Which trait of Islamic rule described in the passage was also evident in Islamic rule in al-Andalus? a. Th
If mC = 36°, then mZH = 54º. True or false
Which organism in an ecosystem eats other organisms? A. decomposer B. consumer C. producer D. prey
Write a program that takes as input an arithmetic expression followed by a semicolon ";". The program outputs whether the expression contains matching grouping
6 cm 4 cm 7 cm It’s a rectangular pyramid.
Explain the process von helmont used to eliminate soil as a source of nourishment and focus and water.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
solve the equation 6x+7=8x-15
what simple machines are used in a mechanical pencil
You place an order for 300 units of inventory at a unit price of $135. The supplier offers terms of 3/10, net 60. a-1. How long do you have to pay before the ac