hillcierra44
hillcierra44 hillcierra44
  • 02-02-2021
  • Mathematics
contestada

1) Click on the name of the figure.
ray BC
B
line AB
line segment AB
A
ray AB​

1 Click on the name of the figureray BCBline ABline segment ABAray AB class=

Respuesta :

mejial23 mejial23
  • 04-02-2021

Answer: line segment ab

Step-by-step explanation:ye

Answer Link

Otras preguntas

Describe why plant cells are rigid:
what are the zeros of the polynomial x2+4x-12
Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa
a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w
How did the Hellenistic kings spread Greek culture
How many meters are there in 21 feet?
Fractures of the blank of long bones are especially common in young animals
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
IS THIS A COMMON KNOWLEDGE OR NEEDS CITATION .In December of 2003, Joan Didion lost her husband of forty years, John Gregory Dunne, after a massive heart attack
What distinguished the bantu religion from buddhism, christianity, and islam?