barryb1 barryb1

02-02-2021
Mathematics

contestada

Find the slope of the line that passes through the points (–1, 6) and (2, 15)

Respuesta :

Аноним Аноним

02-02-2021

Answer:

m=3

Step-by-step explanation:

[tex]\frac{15-6}{2-(-1)} =\frac{9}{3} =3[/tex]

Answer Link

Otras preguntas

in 1990, there were 350 cell phone subscribers in the small town of Centerville. The number of subscribers increased by 35% per year after 1990

Please someone help me with this

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Read the following passage written by a teen hero: I want to be a vocal advocate for nature. I reject the idea that I am too young to make a difference. I recen

Which two sets of lines in the poem illustrate that death's power is an illusion? Sonnet 10 by John Donne Death, be not proud, though some have called thee Mig

How would you say good-bye to a friend whom you might not see for a long time? a. Hasta luego. b. Hasta pronto. c. Hasta ahora. d. ¡Adiós! e. Hasta mañana.

The name for people who stay in one place like civilization of china and kroea

What type of plot structure allows authors to follow different characters through their own separate narratives, eventually converging, as the story is resolved

Aerial photographs most often are taken from __________. A. aircrafts B. hot air balloons C. satellites D. space shuttles

help me asap !!!!!!!!