Seudónimo Seudónimo
  • 01-11-2016
  • English
contestada

Which best identifies the point of highest action, or the turning point, in a story?

Respuesta :

Аноним Аноним
  • 01-11-2016
The specific term is the Climax
Answer Link
Аноним Аноним
  • 01-11-2016
The answer is Climax
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
31+34=90-n 45+1=70-k 6×9=41+m
Which body tissue or organ contains the most mitochondria?
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
Give a recursive algorithm for finding the sum of the first n odd positive integers.
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
What is the difference between "Herr" and "Herrn"?