JimaleOmega04 JimaleOmega04
  • 01-03-2021
  • Mathematics
contestada

Factor the expression
(x+2)^2-25y^4

Respuesta :

Ojanaprosno
Ojanaprosno Ojanaprosno
  • 01-03-2021

Answer:

(x+2-5y^2) (x+2+5y^2)

Step-by-step explanation:

......,....................

Answer Link
lisamays32 lisamays32
  • 01-03-2021
−(x+2+5y2)(5y2−x−2)


This is the right answer.
Answer Link

Otras preguntas

Who basically "began" England's religious reformation?
Joe has always believed that he is lousy at athletics. when he tried to play soccer, he was sure he would not be good at it, and indeed, he was not very adept.
(75) pointsPlease help me on these questions ASAP!!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
stuck i need help please
Which great society program was a comprehensive health insurance program for all senior citizens?
A major problem facing italy after its unification was select one: a. papal interference in political elections b. the uneven economic development of the north
What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis
People and societies in which they live lie outside the biosphere.
How would you describe neville chamberlain's policy toward hitler in the late 1930?