cyaloqaqa
cyaloqaqa cyaloqaqa
  • 01-08-2021
  • Mathematics
contestada

find the volume of a cylinder if the radius is 8cm and the height is 15cm?​

Respuesta :

inspirationalgdandyt
inspirationalgdandyt inspirationalgdandyt
  • 01-08-2021

Answer:

3015.92894745 cm^3

Step-by-step explanation:

Formula for volume of cylinder(v)= πr^2h

Here,

r=8 cm

h=15cm

Now,

V=πr^2h=π8^2*15=π64*15=960π=3015.92894745 cm^3

Answer Link
maliswarna5
maliswarna5 maliswarna5
  • 01-08-2021

[tex]2\pir = 1828 + 49 = [/tex]Hey Shona playing how much town

Answer Link

Otras preguntas

The daily sales at a convenience store have a mean of $1350 and a standard deviation of $150. The mean of the sampling distribution of the mean sales of a sampl
During a telephone conference call, Rafaela asks her assistant to complete a report as soon as possible that day. The assistant, however, didn’t understand the
A. $1,200 B. $1,080 C. $24 D. $810
Might there be some benefit to forgetting the events of infancy?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Which statement best summarizes what Churchill is saying in this section? "In front of the iron curtain which lies across Europe are other causes for anxiety. …
Schutz (1958) advanced the notion of three basic interpersonal needs: ____________, control and affection. ____________ refers to the need to be with people and
Find an equation for the line that passes through the points (-3,-2) and (1,4)
What is the meaning of life?​
which of the compounds, C3H8, mgcl2, OCl2 are expected to exist as molecular compounds?