hoangson2424w hoangson2424w

02-08-2021
Engineering

contestada

Hãy tính phản lực liên kết tại ngàm A, bản lề C và gói di động D biết p=400N/m
P1=100N
P2=200
P3=300
M1=100N/m
N2=200N/m

Respuesta :

alishabhusal2065 alishabhusal2065

09-08-2021

Answer:

say in English plz I don't understand

Answer Link

Otras preguntas

What should be the consequences for not completing a required task? Why?

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

True or False. When the Mongols gained control of China, Europeans sent expeditions to their territory to see if they could become allies. Select one: True Fals

Aaron Corporation, which has only one product, has provided the following data concerning its most recent month of operations: Selling price

Choose the best revision for each run-on sentence. 1. Roosters begin to crow at dawn they seem to act as a natural alarm clock for the other animals. A. Rooste

What is 2500+28566+23x2= -----

Which types of natural processes have assisted in a geological evolution of earth?

This is a character who changes their personality, attitude, and/or beliefs over time. This change is usually a result of a conflict. Question 4 options: Prota

Highlight the subject in yellow, verb in red and the direct object in blue. 1. Tú escribes una carta a Jaime.

The addition of the 13th Amendment to the United States Constitution in December of 1865..Question 1 options:made the Emancipation Proclamation law by ending sl