priushunter3016 priushunter3016

02-08-2021
History

contestada

If a citizen commits an ordinance violation in Mississippi, who oversees the case?

Respuesta :

theallmight123 theallmight123

02-08-2021

Answer:

If the conduct of the officer is found to be a violation of law, the district attorney shall file the appropriate criminal charges and prosecute the officer.

Answer Link

Otras preguntas

The scale of the drawing was 1 millimeters,2 meters in the drawing, the lawn in the backyard is 28 millimeters long, what is the length of the actual lawn

what type of reaction is sodium reacting with chlorine

According to the American Psychological Association, what is the most significant source of stress for Americans? (2 points) Health Money Education Work

Does it matter when finding if a slope is positive or negative if the linegoes through the origin?

"Peace Terms with Jerusalem, 636 CE," 10th century 1. Which trait of Islamic rule described in the passage was also evident in Islamic rule in al-Andalus? a. Th

Solid potassium chromate is slowly added to 175 mL of a lead(II) nitrate solution until the concentration of chromate ion is 0.0366 M. The maximum amount of lea

The length of the base edge of a pyramid with a regular hexagon base is represented as x. The height of the pyramid is 3 times longer than the base edge. The he

Is y= x^2-1 a linear equation?

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What's the definition of the rooting reflex?