cozyheatherbee
cozyheatherbee cozyheatherbee
  • 01-09-2021
  • Mathematics
contestada

help need an answer asap​

help need an answer asap class=

Respuesta :

opueneali
opueneali opueneali
  • 01-09-2021

Step-by-step explanation:

1. set of even numbers

3. set of months that start with J

4. set of vowel sounds

5. set of days that start with T

6. set of perfect squares

Hope this helps please like and mark as brainliest

Answer Link

Otras preguntas

The graph of the linear function fpasses through the point (1. -9) and has a slope of -3. What is the y intercept?​
Escoge el artículo y adjetivo correcto de la siguiente palabra: 1. _____ amigos 2. ______ 1. Muchas Muchos Mucho Mucha Simpáticos Simpático Simpáticas Simpática
Which world does Crisis belong to? A. Ordinary (Known) B. Unknown c.Both ​
If all the deer disappeared from this community, which change would be most likely to occur? coyote-cougar squirrel mouse deer # 4 grass acorns mushrooms A. The
Write a short essay that draws on details in both the illustration and the speech to create a definition of America's promise. Use definition strategies that wi
A fin whale is swimming at the speed of 35 km/h how many hours will it take to swim 7 km
Convert the following sentence from compound to complex sentence. Water is an endangered resource and we cannot live without it. I'll tag the best answer brain
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Explain how diseases helped Europeans conquer parts of the New World?
The Mayan developed a language, system of numbers, and a calendar. True False