vert50
vert50 vert50
  • 01-09-2021
  • Mathematics
contestada

Pls help I’m so confused

Pls help Im so confused class=

Respuesta :

Witcher3
Witcher3 Witcher3
  • 01-09-2021

[tex]5x-6-x=2x+2\\\\5x-x-2x=2+6\\\\2x=8 \ \ /:2\\\\x=4\\\\\huge\boxed{\text{There is one solution at x=4}}[/tex]

Answer Link
leov11
leov11 leov11
  • 01-09-2021

Answer:

There is one solution at x+4

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was
When did christianity become the official religion of the roman empire?
Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _
What was OPEC protesting when it imposed it's embargo?
Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf
There are 36 ways two dice can land: six ways for the first die and six ways for the second die. in how many of those ways does at least one of the dice show a
Help me please im about to give up
Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.
HR contains six red chili beans for green jellybeans and four blue jelly beans if we choose a jellybean then another jellybean without putting the first time ba