Edevos1
Edevos1 Edevos1
  • 01-12-2021
  • Mathematics
contestada

Help please!!!!
Find the measure of the angle indicated

Help please Find the measure of the angle indicated class=

Respuesta :

TheArkhamKnight1234 TheArkhamKnight1234
  • 01-12-2021

Answer:

x = 6

Step-by-step explanation:

Because we have parallel lines, we can use alternate angles are equal. Therefore, we know that 11x-6 = 10x.

Minus 11 from both sides, and we get -6 = -x, so x = 6

Answer Link

Otras preguntas

Susan ........ (Run) to school because she was late.
when Jefferson took office he did what
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
A light bulb converts electrical energy into electromagnetic energy is true or false?
does a human body use neon???
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.