williamandrews9116 williamandrews9116

01-04-2022
History

contestada

Spanish conquistadors searched the andes for which lost golden city?.

Respuesta :

audreycray724 audreycray724

01-04-2022

They searched for El Dorado one of the infamous cities in the andes.

Answer Link

Otras preguntas

Satellite can focus on specific latitudes using?

A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.

How and where (at what latitudes) do atmospheric convection cells form?

BC is parallel to DE What is AC? Enter your answer in the box.

PLEASE HELP ASAPPPPPP An advertiser rents a rectangular billboard that is 44 ft wide and 20 ft tall. The rent is $15 per square foot. For a billboard twice as t

PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe

Find 8 + 35 + (-76).

A major weakness of the new constitution was the bill of rights. a. True b. False