king449280 king449280

03-04-2022
Mathematics

contestada

40 students go to a sport centre in buses. a bus can hold 14 students. find the number of buses needed

Respuesta :

zacharynoe5510 zacharynoe5510

03-04-2022

Answer:

The answer is 3 buses

Step-by-step explanation:

40 divided by 14 is 2.85714285714 buses well you cant have 3/4 of a bus so you round it up to 3 buses

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

stars and planets are made from gases in a

(50)points 5 questions

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

describe five ways to set strategy for effectively gathering patients information

A 12-foot ladder leans against the side of a house with its base 3 feet from the house. use the pythagorean theorem to approximate how high the ladder reaches u

A pp plant is making gametes. how many types of gametes, and in what proportions, will there be

Satellite can focus on specific latitudes using?

N general, emerging adulthood is a time during which a person functions physically and psychologically at an optimal level.

What do the tympanic membranes do for the frog?