Seudónimo Seudónimo
  • 03-05-2022
  • Mathematics
contestada

Factor $-2.8$ out of $-16.8m-11.2$ .

Factor 28 out of 168m112 class=

Respuesta :

scoringninja365 scoringninja365
  • 03-05-2022
-2.8(6m + 4) that is the answer
Answer Link

Otras preguntas

Do all your pet's offspring look the same? If no, then explain why they look different.
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Fossils are most commonly found in which type of rock?
does a human body use neon???
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
In which system of government would states function independently of each other?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5