ksprattlin24 ksprattlin24

02-07-2022
Mathematics

contestada

Simplify 1-4 can you show how you got the answer on a sheet of paper. Really need help

Simplify 14 can you show how you got the answer on a sheet of paper Really need help class=

Respuesta :

sabitachapagain21 sabitachapagain21

02-07-2022

Answer:

first 1*3+1-3*4+1

then it is in fraction

the answer is -5

Answer Link

Otras preguntas

1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession

a club has 5 members. from these members, the positions of president and vice-president have to be filled. how many different ways can these 2 positions be fill

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A solution is select one: a. nonuniform. b. homogeneous. c. heterogeneous.

World population is approximately upper p equals 6.4 left-parenthesis 1.0126 right-parenthesis superscript t, with upper p in billions and t in years since 2004

who invented the glass harmonica

If f(x) = x2 – 25 and g(x) = x – 5, what is the domain of mc006-1.jpg?

Please help me with this one too !!!

Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she

Given: The coordinates of triangle PQR are P(0, 0), Q(2a, 0), and R(2b, 2c). Prove: The line containing the midpoints of two sides of a triangle is parallel to