BhavikaB262593 BhavikaB262593
  • 03-11-2022
  • Mathematics
contestada

Write8600asaBabylonianNumeral.

Respuesta :

NissimG110452 NissimG110452
  • 03-11-2022

First we need to divide 8600 by 3600 and the remainder divide it by 60, let's see how it goes:

This means that we can write 8600 like this:

[tex]8600=3600x2+60x23+20[/tex]

With the quotients and the laste residue we can make the block of symbols:

Ver imagen NissimG110452
Ver imagen NissimG110452
Answer Link

Otras preguntas

Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
solve the simultaneous equation 4x+7y=1 3x+10y=15
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
A vehicle is only 15% efficient. What happened to the other 85%?
why is it critical to your cells to be near capillaries