altaviouso altaviouso

03-03-2017
Mathematics

contestada

What is the area of the trapezoid? Enter your answer in the box. Please help and quick!

What is the area of the trapezoid Enter your answer in the box Please help and quick class=

Respuesta :

Аноним Аноним

03-03-2017

The answer is 88 hope this helps!!

Answer Link

Otras preguntas

Carrie needs to make 16 costumes for the school play. Each costume requires 2-1/4 yards of material. How many yards of material will she need? a 36 b 32-1/4

A solution was prepared by dissolving 125.0 g of KCl in 275 g of water. Calculate the mole fraction of KCl. (The formula weight of KCl is 74.6 g/mol. The formul

Jerica takes her young son to the pediatrician for regular childhood immunizations. While there, they wait in a room full of sneezing, sniffling, coughing young

Mr. Pirzada Lines 496–499: What feeling is created by the sentence “My mother did not seem particularly relieved to hear from me”? What is the reason for that

Write a function that takes as input an English sentence (a string) and prints the total number of vowels and the total number of consonants in the sentence. Th

Which of the following statements is true? Algae belong to the Plantae kingdom. Bacteria belong to the Protista kingdom. Organisms in the Monera kingdom are pro

Solve 2x^2 + 6x = 36 by graphing the related function.

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

The average age of the onset of puberty has changed over time. Which of the following individuals is most likely to have started puberty at the latest age? A.

Help me part a and B