jemgirl86
jemgirl86 jemgirl86
  • 01-05-2017
  • Mathematics
contestada

Geometry please help!

Geometry please help class=

Respuesta :

bcalle
bcalle bcalle
  • 01-05-2017
Use Pythagorean theorem to solve for missing side.
a^2 + b^2 = c^2
6^2 + b^2 = 14^2
36 + b^2 = 196
Subtract 36 from both sides.
b^2 = 160
Sqrt both sides
b = sqrt 160
b = 4 sqrt 10
Letter D
Answer Link

Otras preguntas

Sancho Panza is the farmer who acts as Quixote's 1._______. When Quixote attacks a 2.______ in the passage, Panza him 3_______. the choices for these are 1.co
Which weighs more? a.they both weight exactly the same. b.four protons c.two neutrons and two protons in a helium nucleus?
What are two concepts of government democracy?
An account earns simple interest. Find the annual interest rate, I= $60 P= $500 t= 2 years
Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h
Social disparity was one of the major causes of french revolution. Justify the statement
who is the present president of liberia
How do the structures of alveoli and capillaries support the function of gas exchange?
How was fidel castro able to maintain cuba's independence as a communist state while only being 90 miles off the coast of the united states?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat