quinnlangley22 quinnlangley22
  • 04-05-2017
  • Geography
contestada

Why is the Rhine River important to Western Central Europe?

Respuesta :

dariapettiford1 dariapettiford1
  • 04-05-2017
It is the most important waterway (in Germany) because it's linked by canals to other major rivers, it's the busiest shipping route in the world .
Answer Link
Christoph84
Christoph84 Christoph84
  • 05-05-2017
it's the busiest shipping/trade route in the entire world
Answer Link

Otras preguntas

Please help ASAP!!!! 100 points!
A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What was one of the two major goals that the national organization for women work towards when it was first founded?
What does President Lincoln express he did not want to do?
Help plsssssssssssss
Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.
why is derek miller's social media post different than most?
In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the
difference between syntax and semantics