jalonndbooth62 jalonndbooth62

03-10-2017
Mathematics

contestada

Corey buys 4.16 pounds of apples for $5.20 how much does one pound cost

Respuesta :

choixongdong choixongdong

03-10-2017

$5.20 / 4.16 = $1.25 per pound

answer

it cost $1.25 one pound

Answer Link

Otras preguntas

When a red blood cell is placed in hypotonic (very dilute) solutions of nacl?

what does the constitution state about the interaction of the judicial branch and new laws

What is the lowest level of measurement that a median can be computed?

plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.

what played a great role in the kansan nebraska act

An account earns simple interest. Find the annual interest rate, I= $60 P= $500 t= 2 years

Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.

Adrien needs to use an effective sanitizer to finish cleaning a piece of equipment; he should use a_____ A.sanitizer at a temp of 60F B.sanitizer that has more

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false