JCarbah1389 JCarbah1389
  • 03-11-2017
  • Social Studies
contestada

African american female characters who often appear as scenery in the background

Respuesta :

ahmedishaal ahmedishaal
  • 14-11-2017

African American female characters, who often appear as scenery in the background of television shows serve to perpetuate "stereotypes”. Racial, sexual and gender remarks are the biggest stereotypes in the contemporary world of ours today.

Answer Link

Otras preguntas

How do I do trebuchet calculations????? Help me please
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
testosterone directly affects the
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why was wilson not able to finish his speaking tour
What kind of problems did increased urbanization cause? During time of industrial revolution
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate