Inneedofhelp6728 Inneedofhelp6728

03-02-2016
Mathematics

contestada

Which number is irrational?

A) 3/17
B) √25
C) 0.6 (the six has a line on top of it)
D) √33

Respuesta :

Jadarosborough Jadarosborough

03-02-2016

the answer is D) the square root of 33 because when you type it in a calculator, that number cannot be expressed as a ratio of integers.

Answer Link

Otras preguntas

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

help me asap !!!!!!!!

When citizens _______, they help elect people who carry out government tasks. A. vote B. volunteer C. lobby D. nominate

A cat falls out of a tree and takes 1.4 seconds to land safely on its paws on the ground how many meters did the cat fall ?

Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re

The element with the most stable nucleus and smallest mass per particle is

How did censorship and propaganda help fortify post ww1 dictatorships?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

circadian rhythm refers to

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim