dewaynejoneslusk dewaynejoneslusk
  • 03-12-2018
  • Mathematics
contestada

test 85743 for divisibility by 2,3,5,9 and 10

Respuesta :

alansiby07
alansiby07 alansiby07
  • 03-12-2018

Answer:

It is divisible by 3 and 9

Step-by-step explanation:


Answer Link

Otras preguntas

What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
Susan ........ (Run) to school because she was late.
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number