ash24 ash24
  • 03-04-2015
  • Biology
contestada

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Respuesta :

flyingcaprinekid
flyingcaprinekid flyingcaprinekid
  • 04-04-2015


the matching (complementary) strand would be:

ATGCCATTCGTAGAACCGTATTGGGGTTAA

Answer Link

Otras preguntas

Billy wants to buy 657 mugs. The mugs are sold for a price of 3 for $4. How much must Billy pay for all the mugs?
When iron metal reacts with oxygen, the reaction can form Fe2O3. Write a balanced chemical equation for this reaction, and find the number of moles of oxygen th
Geologists map out ___ from previous earthquakes to determine earthquakes risk A. graphs B. buildings C. data D. none above
When iron metal reacts with oxygen, the reaction can form Fe2O3. Write a balanced chemical equation for this reaction, and find the number of moles of oxygen th
what developments were the foundation of the Scientific Revolution
What is “yellow journalism”? A. sensational and often scandalous news stories B. intentionally inaccurate and confusing news stories C. new stories written
Tony works 22 hours per week. His take home pay is $15.80 per hour. If Tony is able to save all of his earnings, how long will it take him to save at least $4,8
This political cartoon describes the peace process after World War I. Answer the following questions based on the political cartoon and your knowledge of the T
estimate the product of 68 and 21
Name two cell structures found in plant cells but not in animal cells, and describe their functions.