iloveme1099578 iloveme1099578
  • 03-04-2020
  • Mathematics
contestada

Please help me please!!!!

Please help me please class=

Respuesta :

amna04352
amna04352 amna04352
  • 05-04-2020

Answer:

1 F

2 C

3 G

4 D

5 A

6 E

7 B

Step-by-step explanation:

p implies q (conditional)

Which is G

It's converse would be

q implies p

Which is G

F and G together become bi-conditional

Which is B

Contraposition is

not q implies not p

Inverse of p implies q is

not p implies not q

Which is D

Conjunction is p and q,

Which is F

Disjunction is p or q,

Which is C

Answer Link

Otras preguntas

Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
what's the percentage of 1/8 ?
What are some methods used by Mussolini to rise to power?
what are the 2 major types of cofactors?
why is the square root of a perfect square always rational
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
the temperature of a sample of matter is a measure of the ?
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place