famcervantes4
famcervantes4 famcervantes4
  • 02-11-2020
  • Medicine
contestada

Why do you think it is important for scientists to organize life into a hierarchy for study?

Respuesta :

alli029
alli029 alli029
  • 03-11-2020

Answer:

It keeps the information organized, and easy to comprehend.

Explanation: it helps us categorize organisms so we can more easily communicate biological information. It is also a way to help scientists understand and organize the diversity of life on our planet.

Answer Link

Otras preguntas

What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
who was the founder of Pennsylvania?
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
how can you write 0.45 as fraction and a percentage ,please show work
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.