YoussefQ424255 YoussefQ424255
  • 03-11-2022
  • Mathematics
contestada

i will send a pick of the problem

Respuesta :

EdwinaH392010 EdwinaH392010
  • 03-11-2022

we have that

Verify each statement

1) AE≅DE -----> given ----> is ok

2) BE≅CE ----> given ----> is ok

3) AB=DC----> opposite sides congruent----> is not ok

4) m by vertical angles

5) Δ AEB≅ΔDEC -----> by SAS congruence postulate

therefore

Sarah is not correct

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Did feudalism create a stable form of government?
What were the driving forces behind the industrial revolution
What would be the most likely effect of one company buying a competitor?
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Why did the french revolution happen and who's fault was it
A generator stores electric current. Explain why you agree or disagree with this statement