emi8leytalaze emi8leytalaze
  • 01-05-2017
  • Health
contestada

Why are the b vitamins especially important to an athlete?

Respuesta :

andriansp andriansp
  • 09-05-2017
the reason why b vitamins especially important to an athlete is:  The B vitamins are directly involved in energy metabolism.

Due to the hard exercise, athletes' body will demand a lot of Calories intake to obtain their energy level. Vitamin b is essential in breaking the substance they get from the food and convert it to energy.
Answer Link

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
What are some methods used by Mussolini to rise to power?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
What was religion like in Shang China?
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
does radiation need a phase of matter to travel with?
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s