ash24 ash24
  • 03-04-2015
  • Biology
contestada

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Respuesta :

flyingcaprinekid
flyingcaprinekid flyingcaprinekid
  • 04-04-2015


the matching (complementary) strand would be:

ATGCCATTCGTAGAACCGTATTGGGGTTAA

Answer Link

Otras preguntas

You and two friends got jobs at stores in the mall. You earn $117.60 for 14 hours of work. Ty earns $148.50 in 18 hours. Kim earns $137.60 in 16 hours. Who has
An essay on "Welfare of my society depends on my well being"
Which of the following has been the main cause of land grant disputes over time? A.more than one government made land grants in New Mexico. B.spanish land gran
Currently, there are members of the United Nations.
Who would have been most likely to support and help poor women In major urban areas
Which of the following is true of a eukaryotic cell in a multicellular organism? a.possess ribosomes b. possess a cell membrane c. possess a nucleus d. pos
One way in which the Federal Trade Commission (1914) and the Clayton Antitrust Act (1914) are similar is that both (1) helped to end child labor in factories (2
Which group on the Periodic Table has elements with atoms that tend not to bond with atoms of other elements? (1) Group 1 (3) Group 17 (2) Group 2 (4) Group 18
11 Which substance can not be broken down by a chemical change? (1) ammonia (3) ethane (2) arsenic (4) propanal
Some fractions have a denominator that is greater than the numerator. Some fractions have a numerator that is greater than the denominator. Can you find one of