ash24 ash24
  • 03-04-2015
  • Biology
contestada

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Respuesta :

flyingcaprinekid
flyingcaprinekid flyingcaprinekid
  • 04-04-2015


the matching (complementary) strand would be:

ATGCCATTCGTAGAACCGTATTGGGGTTAA

Answer Link

Otras preguntas

Which of the following cell organelles surrounds the nuclear membrane? Rough endoplasmic reculum
List a possible set of four quantum numbers (n,l,ml,ms) in order, for the highest energy electron in gallium?
She walks in beauty, like the night Of cloudless climes and starry skies; And all that’s best of dark and bright Meet in her aspect and her eyes; Thus mellowed
if a supreme court justice were to argue using a precedent what might he or she do
What was Prometheus's punishment for giving fire to humans
SpongeBob noticed that his favorite pants were not as clean as they used to be . His friend Sandy told him that he should try using Clean-O detergent, a new bra
you have decided to purchase a car for $15,699. the credit union requires a 10% down payment and will finance the balance with a 6.1% annual interest loan for 3
This is NOT one of Aristotle's classifications of governments. a. autocracy c. totalitarian dictatorship b. oligarchy d. democracy
To affect the market outcome, a price ceiling A. must be set below the black market price. B. must be set below the legal price. C. must be set below the price
you should ask all of the following questions as you listen to a speaker except. a. what is this speech about? b. what is the purpose of this speech? c. what or