hchdjie5337 hchdjie5337
  • 01-03-2018
  • History
contestada

What are the two principles to the jus in bello part of the just war theory?

Respuesta :

Diana187
Diana187 Diana187
  • 01-03-2018
The purpose of the doctrine is to ensure war is morally justifiable through a series of criteria, all of which must be met for a war to be considered just. The criteria are split into two groups: "right to go to war" (jus ad bellum) and "right conduct in war" (jus in bello).
Answer Link

Otras preguntas

lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
2ln(5x)=8 solve for x
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
what are the 2 major types of cofactors?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Did feudalism create a stable form of government?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate