Seudónimo Seudónimo
  • 01-02-2016
  • History
contestada

What part of the us government interprets laws ?

Respuesta :

ehaynie ehaynie
  • 01-02-2016
The Judicial Branch, or the federal court system, interprets the law.
Answer Link

Otras preguntas

A light bulb converts electrical energy into electromagnetic energy is true or false?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Susan ........ (Run) to school because she was late.
what is the lcd of 10/11,29/44
Susan ........ (Run) to school because she was late.
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5