babij5808 babij5808

04-06-2018
Biology

contestada

The decrease in height that can occur in older adulthood results mainly from change in what body area

Respuesta :

elimkay elimkay

04-06-2018

The decrease in height is caused by the discs between vertebrae compressing.

Answer Link

Otras preguntas

Sophie opened a picture of a tree on her cell phone screen and zoomed in 2.5 times. The new scale of the picture became 1 : 168. What would be the scale if it w

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

How did the treaty of 1646 lead to Bacon’s Rebellion?

How did the 7 year was negatively affect the colonies?

159,095 rounded to the thousands

HELP!!! The town council votes to construct an energy plant on the bank of a large river. It uses river water in its cooling tanks and releases the wastewater b

What is the GCF of 525, 135, 750

Solve for x :14x + 2 = 9x - 3

What are the values of G(x) and H(x) that make the equation true?

define the following text structures: claim/evidence compare/contrast cause and effect summary