Ineedabitofhelp Ineedabitofhelp

01-03-2016
Mathematics

contestada

Which relation is a function? A. (–25, 16), (0, 16), (–25, 18) B. (19, 11), (34, 12), (34, 10) C. (35, 31), (24, 15), (12, 0) D. (34, 30), (18, 17), (34, 15)

Respuesta :

01-03-2016

The answer is C because the Y doesn't have any of the same factors.

Answer Link

Otras preguntas

which of the following statements agrees with the second law of thermodynamics

If XY=18, YZ=14, and XZ=20, find the radius of each circle.

The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u

True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.

Name all of the traits that the mackerel has, based on this cladogram.

Which phrase states a principle that was part of president woodrow wilson's fourteen points?

Why did North Carolina and South Carolina split into two colonies? A. They had different beliefs about slavery. B. They had large groups of competin

How is parasitism different from commensalism? a. both organisms benefit in parasitism and only one organism benefits in commensalism. b. one organism benefits

Does the increase in blood glucose levels increase the viscosity of the blood

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat