alexygalindo065 alexygalindo065

02-07-2018
English

contestada

In a drama, what is the actors main responsibility

Respuesta :

Wolfhound905 Wolfhound905

02-07-2018

The number one responsibility is to interpret how a character sounds and act

Answer Link

LinkThePenguin21 LinkThePenguin21

02-07-2018

They are supposed to be the performers and act out the script of the drama.

Answer Link

Otras preguntas

There are 13 sixth grade classrooms at LMMS. Each class has about 28 students. About how many students are there in the whole sixth grade?

a what model might include a drawing or a three-dimensional object.

What are the ways that one's learning can be affected through their environment

under which circumstances is it permitted to share an unclassified draft document

2. I love drawing 3. They travel by airplane. D O W N 1. Do you like 10. To study => 11. To die => 12. To listen => painting. doing TV? 4. he swim ev

Suppose that you have just been accepted as an apprentice to a stonemason. Write a short letter to a friend describing what this means for you and what the next

The process by which a new community forms where no community has lived before: Group of answer choices Primary Succession Secondary Succesion

Sand dunes during the Dust Bowl are an example of: arid windward desertification leeward

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

If ∆ABC is rotated 90° counterclockwise around the origin, what are the coordinates of the transformed figure ∆A’B’C’ ?