nikkikeymurrahs nikkikeymurrahs

01-04-2016
English

contestada

Hopkins's use of "seared," "bleared," and "smeared" is an example of
A. assonance.
B. simile.
C. alliteration.
D. metaphor.

Respuesta :

WorldlyGlass49 WorldlyGlass49

11-04-2016

This is an example of A. assonance.

He uses the vowel sound diphthong EA in consecutive words which makes it an assonance.

Answer Link

Otras preguntas

What was dust bowl in the 1920?

The radius of the smaller circle is 8 feet. The distance from the rim of the inner circle to the rim of the outer circle is 3 feet. A circular garden with a rad

Which of the following is false regarding the employer-employee relationship? Multiple Choice An employee is subject to the control of his or her employer Gener

Un automóvil sale de una estación y recorre en linea recta 400 metros a la derecha , luego se devuelve 500 metros se detiene y vuelve a correr 100 metros a la d

2x-5=3x+6 Cuanto es

The image shows Isotherms on a map.What temperature pattern do the isotherms show?A. lemperatures increase from south to north.B. There is a zone of low tempera

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What is the volume of the prism shown below? 8 cm 10 cm

Who was like Joseph Stalin in Animal Farm?

Bracken, Louden, and Menser, who share profits and losses in a ratio of 4:2:2, respectively are partners in a home decorating business that has not been able to