tlmartin860282 tlmartin860282

01-06-2019
English

contestada

what is it when a narrator is part of the story using he or she

Respuesta :

PoeticAesthetics PoeticAesthetics

01-06-2019

This means that the story is being told in third person point of view!

Hope this helped!

~Just a girl in love with Shawn Mendes

Answer Link

Otras preguntas

one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the

Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before

how do you say theatre in Spanish

a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?

The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.

the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.