unknown832483 unknown832483
  • 02-12-2019
  • English
contestada

what finally convinces the animals to fight

Respuesta :

bangtan77 bangtan77
  • 02-12-2019
There is no evidence to answer this question?
Answer Link
donkeymayo donkeymayo
  • 02-12-2019

Answer: There is not enough evidence to answer this question but I will try to give some reasons of why animals will fight. Animals will fight if their young are being endangered by a perceived or real predator. They will fight if the they themselves are in real or perceived danger. They might fight for no reason if they have rabies. Animals might also fight if they are extremely hungry.

Hope this helps!  :)

Explanation:

Answer Link

Otras preguntas

A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
What is the additive inverse of -4a
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
why is the square root of a perfect square always rational
what's the percentage of 1/8 ?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how to i do 7/16÷(31/2÷1/2)