frascinopeytin frascinopeytin
  • 02-12-2019
  • Biology
contestada

what would you cross a round pea with to determine if it were heterozygous or homozygous dominate​

Respuesta :

hirabajwa81
hirabajwa81 hirabajwa81
  • 02-12-2019

Answer:

It will be crossed with a homozygous recessive i.e wrinkled pea plant.

Explanation:

This test is known as Test Cross which is used to identify the homozygous or heterozygous dominant genotypes.

If the cross gives all round pea plants then the parent round pea was Homozygous Dominant.

If the cross gives 50% or even any quantity (even 1) of wrinkled pea plant then the parent round pea was Heterozygous Dominant.

Answer Link

Otras preguntas

What is the solution 4x+1y ≤48 and 10 ≤y ?
What is - 3/8 divided by 7/12 a. - 7/32 b. - 32/7 c. - 14/9 d. - 9/14
Multivitamin/mineral supplements should never be given to toddlers. a. True b. False
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How would you describe neville chamberlain's policy toward hitler in the late 1930?
How did the Hellenistic kings spread Greek culture
Read the following excerpt from Sandra Cisneros’s story "Mericans." They’re not from here. Ladies don’t come to church dressed in pants. And everybody knows me
Which hormone is essential to our ability to maintain our fluid levels?
Solve for x in terms of the other matrices and/or their inverses. x=b+ax
What did Chinese traders exchange with Islamic merchants?