jc8704652 jc8704652
  • 03-02-2020
  • Biology
contestada

Which statements describe global winds

Respuesta :

6027
6027 6027
  • 22-02-2021

They flow from the same direction.

They travel over short distances.

They generate land breezes.

They blow away from the poles to the equator.

The options i have

Its D

Answer Link

Otras preguntas

(50)points 5 questions
__________ is a good example of congressional casework. analysis of an incumbent's policy positions prior to a debate analysis of water quality within a distric
How did censorship and propaganda help fortify post ww1 dictatorships?
zimmerman note definition
When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Find the missing length indicated
Why might echinoderms make a more appropriate study species for making inferences about humans than other commonly studied species such as drosophila fruit flie
What is the solution 4x+1y ≤48 and 10 ≤y ?
Explain the translation process that results in production of a polypeptide