natalyavillamar natalyavillamar

03-02-2020
Social Studies

contestada

The narrow bay formed by the movement of a large glacier is a:

Respuesta :

beingteenowfmao beingteenowfmao

03-02-2020

Answer:

Fjords

Explanation:

Fjords are narrow bays formed by glaciers.

Answer Link

Otras preguntas

In the reversible reaction shown below, r moles of a react with s moles of b to produce t moles of c. which equation can be used to represent the equilibrium co

A person is selected at random from a crowd. You want to find the probability of the event that this person is a female and the probability of the event that th

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Every month Tristan deposits $488 into an interest-bearing account to save for a down payment on a house. The interest rate on the account is 5.27% compounding

Where did the majority of people t ravel from who were heading to make a new life out of the west?

In what country did the zimmerman telegram originate? a. germany c. russia b. france d. italy

Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi

distillation definition chemistry

a sample of dna contains 20 percent adenine and 30 percent cytosine. What percentage of tymine would you expect to find.

How did the cold war shape american culture in the late 1950s and 1960s? what was the most important impact?